NSs Protein of Rift Valley Fever Virus Blocks = Interferon Production by Inhibiting Host Gene Transcription

Abstract

Rift Valley fever = virus=20 (RVFV) is an important cause of epizootics and epidemics in Africa = and a=20 potential agent of bioterrorism. A better understanding of the = factors=20 that govern RVFV virulence and pathogenicity is required, given = the urgent=20 need for antiviral therapies and safe vaccines. We have previously = shown=20 that RVFV strains with mutations in the NSs gene are excellent = inducers of=20 =CE=B1/=CE=B2 interferon (IFN-=CE=B1/=CE=B2) and are highly = attenuated in mice. Here, we=20 demonstrate that NSs is sufficient to block IFN-=CE=B2 gene = expression at the=20 transcriptional level. In cells transiently expressing NSs, = IFN-=CE=B2=20 transcripts were not inducible by viral infection or by = transfection of=20 poly(I:C). NSs with anti-IFN activity accumulated in the nucleus. = In=20 contrast, mutant forms of NSs that had lost their IFN-inhibiting = activity=20 remained in the cytoplasm, indicating that nuclear localization = plays a=20 role. IFN synthesis is regulated by specific transcription = factors,=20 including interferon regulatory factor (IRF-3), NF-=CE=BAB, and = AP-1. In the=20 presence of NSs, IRF-3 was still activated and moved to the = nucleus.=20 Likewise, NF-=CE=BAB and AP-1 were activated normally, as shown in = electrophoretic mobility shift assays. Moreover, NSs was found to = inhibit=20 transcriptional activity of a constitutive promoter, in agreement = with=20 recent findings showing that NSs targets the basal cellular = transcription=20 factor TFIIH. The present results suggest that NSs, unlike other = viral IFN=20 antagonists, does not inhibit IFN-specific transcription factors = but=20 blocks IFN gene expression at a subsequent step.

Interferons (IFNs) constitute a first = line of=20 host defense against viral infections. IFN-=CE=B1/=CE=B2 is = induced by virus or by=20 double-stranded RNA (dsRNA) in many cell types, whereas IFN-=CE=B3 = is produced=20 by activated T cells and natural killer cells. To overcome the = antiviral=20 response, viruses have evolved various strategies to inhibit = either IFN=20 production, IFN signaling, or IFN action (13,=20 16).=20 The efficiency by which a virus antagonizes the IFN system is = critical for=20 its pathogenicity and its ability to infect and spread in the host = organism.

Rift Valley fever virus (RVFV), a phlebovirus, belongs to the = family=20 Bunyaviridae. It is transmitted by mosquitoes (11)=20 and infects a wide range of vertebrate hosts. In humans, infection = can=20 lead to fatal hepatitis with hemorrhagic fever and encephalitis. = In=20 cattle, infection generally causes death in young animals and = abortion and=20 teratogenesis in pregnant females (14,=20 30).=20 The disease is endemic in many countries of sub-Saharan Africa and = in=20 Egypt, where it repeatedly provokes serious epizootics and = concomitant=20 epidemics. Recently, simultaneous outbreaks occurred in Yemen and = Saudi=20 Arabia (9,=20 10).=20 This was the first time that RVFV manifested itself outside of = Africa,=20 raising fears that the virus will emerge in new areas.

RVFV has a tripartite single-stranded RNA genome consisting of = L, M,=20 and S segments. The L and M segments are of negative polarity and = code for=20 the RNA-dependent RNA polymerase L, the precursor of the = glycoproteins Gn=20 and Gc, and the nonstructural protein NSm, respectively. The S = segment of=20 RVFV uses an ambisense strategy to code for the nucleoprotein N in = the=20 antigenomic sense and the nonstructural protein NSs in the genomic = sense=20 (15).=20 NSs of RVFV is a 31-kDa protein which is phosphorylated by casein = kinase=20 II at two serine residues located in the carboxy terminus (20).=20 It accumulates in the nuclei of infected cells, where it forms = filamentous=20 structures (38).=20 A carboxy-terminal domain mediates oligomerization and is = responsible for=20 filament formation (46).=20 The nuclear localization of NSs is intriguing because all steps of = the=20 viral life cycle are known to occur in the cytoplasm.

Clone 13 is a clonal isolate of RVFV with a large in-frame = deletion in=20 the S segment which leads to a truncated NSs protein (32).=20 This virus is highly attenuated and immunogenic in IFN-competent = mice (8,=20 32,=20 41).=20 However, clone 13 was found to be highly virulent in = IFN-=CE=B1/=CE=B2-nonresponsive=20 mice, pointing to a crucial role of IFN-=CE=B1/=CE=B2 in the = attenuation phenotype=20 (8).=20 In addition, clone 13 proved to be an excellent inducer of early = IFN-=CE=B1/=CE=B2=20 production in vivo. In contrast, the virulent strain ZH548 failed = to=20 induce detectable amounts of IFN-=CE=B1/=CE=B2 and replicated = extensively in both=20 IFN-competent and IFN-defective mice. Analyses of reassortant = viruses with=20 the S segment of either clone 13 or ZH548 provided strong evidence = that=20 NSs is an IFN-=CE=B1/=CE=B2 antagonist in vivo (8).=20 Comparisons of the S segment sequence of clone 13 with that of = ZH548=20 revealed minor differences in addition to the large deletion in = the NSs=20 gene. These correspond to a single amino acid change (glycine to = glutamic=20 acid) at position 159 in the N protein sequence and six nucleotide = changes=20 in the intergenic region (8).

Here we show that NSs is sufficient for suppression of IFN = induction=20 but does not interfere with the activation of IFN-specific = transcription=20 factors. Furthermore, our data demonstrate that the inhibitory = effect of=20 NSs is not restricted to IFN gene expression but affects = constitutive=20 promoters as well, in agreement with recent findings demonstrating = that=20 NSs targets a basal cellular transcription factor (23).

MATERIALS AND METHODS

Cells and viruses. Vero cells, = murine=20 fibroblasts derived from BALB/c mice (BF cells), kindly provided = by=20 Stephen Goodbourn, St. George's Hospital Medical School, London, = United=20 Kingdom, and 293 cells were grown as described (41).=20 Stocks of the RVFV strain ZH548 and clone 13 were produced by = infecting=20 Vero cells with 0.01 PFU per cell. The reassortants were obtained = after=20 coinfection of cells with ZH548 and clone 13 as described = previously (40).

Plasmids for NSs expression. = Plasmids were=20 constructed by standard procedures, and the correct sequences were = confirmed by restriction enzyme analysis and sequencing (2).=20 The sequence coding for NSs (positions 34 to 836 of the genomic = sense RNA)=20 was reverse transcribed and amplified by reverse transcription = (RT)-PCR=20 from RNAs extracted from Vero cells infected with ZH548 or clone = 13 by=20 using primers already described (46).=20 The cDNA fragment was ligated to plasmid pCI (Promega) downstream = of the=20 human cytomegalovirus (CMV) immediate-early enhancer/promoter at = the=20 unique NheI and KpnI sites in the polylinker. This resulted in = plasmids=20 pCI-NSsZH548 and pCI-NSsC13, respectively. The NSs mutated = sequences=20 inserted into plasmids pCI-NSs(S252A), pCI-NSs(S256A), and=20 pCI-NSs(S252A/S256A) were generated from template plasmids = described=20 previously (20).=20 pCI-NSsPP1, pCI-NSsPP2, and pCI-NSsPP3/4 containing substitutions = of=20 alanine for proline were generated by directed mutagenesis using = the=20 ExSite kit (Stratagene). The mutated sequences are indicated below = (see=20 Fig. 4).

FIG.=20 4.
Generation of=20 mutant NSs proteins. Proline residues in PXXP motifs (bold = letters)=20 were replaced by alanines (arrowheads) leading to the mutant = NSs=20 proteins designated PP1, PP2, and PP3/4, respectively. = Exchange of=20 the serine residues (bold, italic letters)=20 (more ...)

IFN titrations. A culture medium of = RVFV- or=20 mock-infected BF cells was exposed to overnight inactivation at pH = 2, and=20 IFN-=CE=B1/=CE=B2 activity was determined in a standard bioassay = using vesicular=20 stomatitis virus infection of L cells (36).

Transfections and reporter assays. = The plasmid=20 pIF=CE=94(=E2=88=92125)lucter (pIF-luc) containing the IFN-=CE=B2 = promoter (positions =E2=88=92125=20 to 72) fused to the firefly luciferase gene was kindly provided by = Stephen=20 Goodbourn (19).=20 The NF-=CE=BAB promoter-reporter plasmid p55A2-luc and the = IRF-3-responsive=20 promoter-reporter plasmid p55C1B-luc were both kindly provided by = Takashi=20 Fujita, The Tokyo Metropolitan Institute of Medical Sciences, = Tokyo, Japan=20 (48),=20 and pAP1-luc and pCF-MEKK were purchased from Stratagene, La = Jolla, Calif.=20 For transfection experiments, the reporter plasmids expressing the = firefly=20 luciferase gene were cotransfected with a control plasmid = expressing=20 either =CE=B2-galactosidase under the transcriptional control of = the CMV=20 promoter (pCMV-=CE=B2Gal) or Renilla luciferase under the = transcriptional control of the SV40 early promoter (pRL-SV40; = Promega,=20 Mannheim, Germany). Cellular extracts for the measurement of = luciferase=20 activity were prepared, and assays were performed as recommended = by the=20 manufacturer (Promega). Beta-galactosidase was assayed by the = standard=20 method. Plasmid IRF-3(5D) was kindly provided by John Hiscott, = McGill=20 University, Montreal, Canada (26).

RT-PCR. Total RNA was extracted from = BF cells=20 infected by RVFV at a multiplicity of infection of 5 PFU per cell = by using=20 Trizol reagent (Invitrogen, Cergy Pontoise, France), digested with = DNase=20 I, and subjected to RT-PCR, using primers specific for murine = IFN-=CE=B2 mRNA=20 and the GAPDH mRNA. The amplified DNAs were examined after = migration in an=20 agarose gel and staining with ethidium bromide. To confirm the = absence of=20 genomic DNA in the RNA preparation, a PCR was carried out without = the=20 preceding RT step.

Northern blot analysis. After = denaturation in=20 the presence of 50% formamide, total RNA was separated by = electrophoresis=20 in a 1% agarose gel containing 6% formaldehyde and transferred = onto a=20 Hybond N membrane (Amersham Biosciences, Orsay, France). = Hybridization=20 with the riboprobes was performed as described elsewhere (5).=20 IFN-=CE=B2- and =CE=B2-actin-specific riboprobes were generated = with SP6 RNA=20 polymerase in the presence of [=CE=B1-³²P]ATP (Amersham = Biosciences)=20 using partial mouse IFN-=CE=B2 and =CE=B2-actin cDNA inserted into = plasmid pGEM-4Z=20 (Promega) as a template.

Western blotting. Cellular extracts = were=20 obtained by lysis with 50 mM Tris (pH 8), 1% NP-40, and 2 mM EDTA = in the=20 presence of protease inhibitors (Roche, Mannheim, Germany), 50 mM = NaF, and=20 1 mM sodium vanadate. The proteins were separated by sodium = dodecyl=20 sulfate-polyacrylamide gel electrophoresis and transferred onto a = Hybond C=20 Extra membrane (Amersham Biosciences) which was incubated = overnight with=20 primary antibodies directed against RVFV nucleoprotein, = I=CE=BAB-=CE=B2 (a gift from=20 Robert Weil, Institut Pasteur, Paris, France), or =CE=B2-tubulin = (Sigma, Lyon,=20 France). Following incubation with horseradish peroxidase-labeled=20 anti-mouse immunoglobulin G, detection was performed by using = Supersignal=20 (Pierce, Rockford, Ill.) according to the manufacturer's = instructions.

Indirect immunofluorescence assay. = Vero cells=20 cultured on coverslips were transfected with wild-type or mutant = NSs=20 expression plasmids using Effectene (QIAGEN, Hilden, Germany) as = the=20 transfection reagent. At 24 h posttransfection, the cells were = fixed with=20 3.2% paraformaldehyde and permeabilized with 0.5% Triton X-100 = (Sigma).=20 The permeabilized cells were then incubated with a mouse anti-NSs = antibody=20 diluted 1:200 (46),=20 followed by incubation with fluorescein-labeled goat anti-mouse=20 immunoglobulin G (Sigma) diluted 1:100 and counterstaining with = Evans blue=20 (Sigma).

IRF-3 translocation assay. Vero = cells were=20 infected with RVFV with a multiplicity of infection of 5. Four = hours=20 postinfection, the cells were fixed with 3% paraformaldehyde and=20 permeabilized with 0.5% Triton X-100. Endogenous IRF-3 and RVFV N = protein=20 was detected by using a polyclonal antibody against IRF-3 (FL-425; = Santa=20 Cruz Biotechnology, Santa Cruz, Calif.) and a mouse anti-N = antibody,=20 respectively (46).=20 IRF-3-specific signals were amplified using the Tyramide signal=20 amplification system (Perkin-Elmer, Rodgau, Germany).

IRF-3 dimerization assay. The IRF-3=20 dimerization assay was carried out as described elsewhere (17).=20 Briefly, at 12 h postinfection, cells were resuspended in lysis = buffer=20 containing 50 mM Tris HCl (pH 7.5), 150 mM NaCl, 1 mM EDTA, 1% = Nonidet=20 P-40, protease inhibitors (complete protease inhibitor; Roche) and = phosphatase inhibitors (phosphatase inhibitor cocktail II; = Calbiochem, Bad=20 Soden, Germany). The lysates were mixed thoroughly, incubated on = ice for=20 10 min, and then centrifuged at 4=C2=B0C for 5 min at 10,000 = =C3=97 g.=20 Cleared cell lysates were separated by nondenaturating gel = electrophoresis=20 in a 7.5% native gel. IRF-3 monomers and dimers were detected by = Western=20 blot analysis using a polyclonal antibody against IRF-3 (FL-425; = Santa=20 Cruz).

Electrophoretic mobility shift = assay. Nuclear=20 extracts from RVFV-infected and mock-infected BF cells were = prepared 5 h=20 after infection as described previously (47)=20 and assayed with a double-stranded oligonucleotide =CE=BAB probe = derived from=20 the H2K^b promoter (H2K^b, 5=E2=80=B2 = TGGGGATTCCCCAT 3=E2=80=B2;=20 H2K^b anti, 5=E2=80=B2 ATGGGGAATCCCCA 3=E2=80=B2), or an = ATF/cJun binding domain=20 derived from the interleukin 8 promoter (AP1, 5=E2=80=B2=20 GAAGTGTGATGACTCAGGTTTGCCTGA 3=E2=80=B2; AP1 anti, 5=E2=80=B2 = TCAGGCAAACCTGAGTCATCACACTTC=20 3=E2=80=B2) (22).=20 The probe labeled with [³²P]ATP in the presence of 10 U = of=20 polynucleotide kinase and [=CE=B3-³²P]ATP (3,000 Ci per = mmol)=20 (Amersham Biosciences) was incubated with the cellular extract and = analyzed in a 6% polyacrylamide gel.

RESULTS

The S segment of RVFV determines = IFN-=CE=B1/=CE=B2 synthesis in=20 infected cells. First, we determined the ability of = different RVFV=20 strains to induce IFN-=CE=B1/=CE=B2 in infected cells. = IFN-competent BF cells were=20 infected with either the virulent wild-type virus ZH548, the = attenuated=20 clone 13 virus, or specific reassortant viruses of the two = strains.=20 Reassortant R406 contains the truncated S segment of clone 13 and = the L=20 and M segments of ZH548 and is designated Z/Z/C, whereas = reassortant R414=20 contains the intact S segment of ZH548 on a clone 13 genetic = background=20 and is designated C/C/Z (8,=20 40).=20 High levels of IFN were detected in cells infected with clone 13 = or Z/Z/C,=20 whereas reduced amounts were found in cells infected with ZH548 or = C/C/Z=20 (Table 1).=20 These results demonstrate that the ability to suppress IFN = production=20 cosegregates with an intact NSs gene and confirmed our previous in = vivo=20 data (8).

TABLE=20 1.
The S = segment of=20 RVFV determines IFN=20 production

NSs-deficient clone 13, but not wild-type = virus,=20 induces IFN-=CE=B2 gene expression. To monitor IFN-=CE=B2 = gene expression in=20 infected cells, accumulation of specific transcripts was analyzed = by=20 RT-PCR using total RNA isolated from BF cells infected with either = wild-type virus or NSs-deficient clone 13. As shown in Fig. 1A,=20 IFN-=CE=B2 transcripts were detected as early as 3 h after = infection with clone=20 13 and became more prominent thereafter. In contrast, no signal = was=20 detectable at any time following infection with wild-type virus. = When=20 IFN-=CE=B2 transcripts were analyzed by Northern blotting, similar = results were=20 obtained (Fig. 1B).=20 To exclude the possibility that the absence of IFN-=CE=B2 gene = transcription=20 was simply caused by an inability of the wild-type virus to = replicate in=20 BF cells, viral protein synthesis was assessed by Western = blotting.=20 Equivalent amounts of N protein were found in cells infected with=20 wild-type or mutant virus (Fig. 1C).

FIG.=20 1.
Induction = of IFN-=CE=B2=20 gene expression in RVFV-infected cells. (A and B) Detection = of IFN-=CE=B2=20 transcripts. Total RNA was extracted from BF cells infected = with=20 either strain ZH548 or clone 13 at the indicated time points = of=20 infection. p.i., postinfection.=20 (more ...)

To assess whether the IFN-=CE=B2 promoter is transactivated in = RVFV-infected=20 cells, we determined the IFN-=CE=B2 promoter activity using a = luciferase=20 reporter construct. Human 293 cells were transfected with the = reporter=20 plasmid pIF-luc and infected with RVFV at 6 h posttransfection. = Cell=20 lysates were prepared at 24 h after infection and assayed for = luciferase=20 activity. Infection with ZH548 stimulated luciferase activity=20 approximately 2-fold, whereas clone 13 infection resulted in = 10-fold=20 stimulation (Fig. 1D).=20 Experiments with BF cells led to similar results (data not = shown).

Taken together, these results indicated that clone 13, but not=20 wild-type virus, is a strong inducer of IFN-=CE=B1/=CE=B2 gene = expression and=20 suggested that NSs is the inhibitory factor.

NSs protein suppresses IFN-=CE=B2 promoter=20 activation. To explore the possibility that NSs itself was=20 suppressing IFN-=CE=B2 gene expression, we expressed NSs from = appropriate=20 plasmids in the absence of other viral components and analyzed its = effect=20 on IFN-=CE=B2 promoter activity. Recombinant NSs of wild-type = strain ZH548=20 formed filamentous structures in the nuclei of transiently = transfected=20 cells; these structures were identical to those observed in = ZH548-infected=20 cells (Fig. 2A).=20 In contrast, the truncated NSs of clone 13 was barely detectable = and=20 located mainly in the cytoplasm (Fig. 2B),=20 in agreement with previous findings (40).=20 To test the activity of recombinant NSs, a firefly luciferase = reporter=20 assay was used in which activation of the IFN-=CE=B2 promoter by = synthetic=20 dsRNA [poly(I:C)] is measured. Poly(I:C) efficiently activated the = IFN-=CE=B2=20 promoter in cells that were transfected with a control plasmid. = Expression=20 of the truncated NSs of clone 13 had no negative effect on the = activation=20 of the IFN-=CE=B2 promoter (Fig. 3A).=20 In contrast, expression of wild-type NSs almost completely blocked = IFN-=CE=B2=20 promoter activation (Fig. 3A).=20 To evaluate the efficiency with which NSs was able to block = IFN-=CE=B2 promoter=20 activation, decreasing amounts of NSs expression plasmids were = used. While=20 60 ng of plasmids resulted in over 95% inhibition of reporter gene = expression, a 12-fold lower dose of 5 ng still led to a reduction = of=20 approximately 75% (Fig. 3C),=20 indicating that NSs is a potent inhibitor of promoter activation.=20 Interestingly, in untreated cells expressing wild-type NSs, the = background=20 level of luciferase activity was always lower than in control = cells not=20 expressing NSs (Fig. 3A=20 and C). Likewise, the =CE=B2-galactosidase activity driven by = a=20 constitutive promoter was also lower (Fig. 3B),=20 indicating that NSs was a general inhibitor of transcription.

FIG.=20 2.
Localization and=20 filament formation of wild-type and mutant NSs proteins. = ZH548 NSs=20 (A), clone 13 NSs (B), NSs-PP3/4 (C), NSs-PP1 (D), NSs-PP2 = (E),=20 NSs-S252A (F), NSs-S256A (G), NSs-S252A/S256A (H). For an=20 explanation of the introduced mutations, see=20 (more ...)

FIG.=20 3.

NSs = protein=20 suppresses IFN-=CE=B2 promoter activation. 293 cells were = cotransfected=20 with the indicated NSs expression plasmids, the reporter = construct=20 pIF-luc, and the control plasmid p=CE=B2Gal. At 24 h = posttransfection,=20 cells were mock treated=20 (more ...)

Nuclear accumulation is required for NSs=20 activity. Sequence analysis revealed that wild-type NSs = contained=20 four PXXP motifs (where P is proline and X is any amino acid) (6,=20 29),=20 namely, motif 1 at positions 29 to 32, motif 2 at positions 82 to = 85, and=20 motifs 3 and 4 at positions 240 to 246 (Fig. 4).=20 It should be noted that motifs 1 and 2 are absent in clone 13 NSs. = In an=20 attempt to analyze the role of these proline-rich motifs, mutant = NSs=20 proteins were generated in which proline residues were replaced by = alanine. Substitutions at motifs 3 and 4 were well tolerated, and = the=20 resulting NSsPP3/4 mutant protein behaved like the wild type, = forming=20 nuclear filaments (Fig. 2C).=20 In contrast, substitutions at motifs 1 and 2 changed the = properties of the=20 molecules. Both mutant forms did not produce nuclear filaments and = remained mainly in the cytoplasm (Fig. 2D=20 and E). When analyzed for their suppressive effect on = IFN-=CE=B2 promoter=20 activation, the two mutants residing in the cytoplasm had lost = most of=20 their inhibitory capacity, whereas the nuclear NSsPP3/4 mutant = protein=20 still inhibited luciferase activity similarly to wild-type NSs = (Fig. 5A).

FIG.=20 5.
Suppression of=20 IFN-=CE=B2 promoter activation by mutant NSs proteins. rel., = relative;=20 =CE=B2-gal., =CE=B2-galactosidase. (A) Effect of NSs on the = activation of the=20 IFN-=CE=B2 promoter. (B) Effect of NSs on the constitutively = active CMV=20 promoter.=20 (more ...)

Next, we investigated mutant forms of NSs in which the major=20 phosphorylation sites were changed (20).=20 NSs is phosphorylated by casein kinase II at serine residues 252 = and 256.=20 Both serines were replaced by alanine, resulting in the single = mutants=20 NSs(S252A) and NSs(S256A) as well as the double mutant = (S252A/S256A) (Fig.=20 4).=20 The three mutants behaved like wild-type NSs (Fig. 2F=20 to H) and blocked IFN-=CE=B2 promoter activity (Fig. 5A).=20 Again, they also affected the basal levels of =CE=B2-galactosidase = expression=20 driven by the CMV promoter (Fig. 5B).=20 Taken together, these results suggested that NSs or its mutant = forms need=20 to be in the nucleus for efficient suppression of transcription, = whereas=20 serine phosphorylation does not seem to matter.

NSs inhibits promoter transactivation = without=20 affecting IRF3, NF-=CE=BAB, or AP1. Virus-induced = activation of the=20 IFN-=CE=B2 gene is an immediate early event which involves the = three key=20 transcription factors interferon regulatory factor 3 (IRF3), = NF-=CE=BAB, and=20 ATF2/cJun (AP-1). These are known to cooperate in transactivating = the=20 IFN-=CE=B2 promoter (43).=20 One of the characteristic steps during activation of IRF3 or = NF-=CE=BAB is=20 nuclear translocation. In the case of IRF3, phosphorylation and=20 dimerization events trigger nuclear translocation (25,=20 37).=20 NF-=CE=BAB is normally retained in the cytoplasm by its inhibitor, = I=CE=BAB, which=20 upon activation is phosphorylated and degraded by the proteasome, = thereby=20 releasing NF-=CE=BAB (18).

To investigate whether activation of IRF-3 is inhibited by NSs, = we=20 assessed the fate of IRF-3 in cells infected with either wild-type = RVFV or=20 clone 13. IRF-3 dimerization and nuclear translocation were both = induced=20 in cells infected with the NSs-deficient clone 13 virus, as = expected (Fig.=20 6A=20 and B). Surprisingly, however, both events also occurred = unhindered in=20 cells infected with the NSs-expressing wild-type virus (Fig. 6A=20 and B). In uninfected control cells, IRF-3 remained in the = cytoplasm=20 in its monomeric form (Fig. 6A=20 and B). Obviously, NSs did not inhibit activation of IRF-3 but = rather=20 blocked a different or subsequent step in promoter activation. If = this is=20 the case, NSs should also be able to block IFN-=CE=B2 promoter = activation by=20 IRF-3(5D), a constitutively active phosphomimetic form of IRF-3 = (26).=20 We therefore examined whether NSs would inhibit IRF-3(5D)-mediated = gene=20 activation in an appropriate reporter assay. Indeed, wild-type NSs = completely abolished the activation of an IRF-3-dependent = promoter,=20 whereas clone 13 NSs was inactive (Fig. 7A).=20 Next, we investigated whether NSs would interfere with NF-=CE=BAB = signaling.=20 Figure 6C=20 shows that infection with clone 13 as well as wild-type virus led = to the=20 degradation of I=CE=BAB-=CE=B2, as revealed by Western blotting. = Compared to that in=20 uninfected cells, the amount of I=CE=BAB-=CE=B2 was clearly = decreased in cells=20 infected with either virus. This effect was not observed in cells = treated=20 with the proteasome inhibitor MG132, indicating true degradation = of I=CE=BAB-=CE=B2=20 by the proteasome (Fig. 6C).=20 Translocation of NF-=CE=BAB into the nucleus was confirmed by gel = shift assays=20 using a probe which contained the NF-=CE=BAB binding site. = Incubation with=20 nuclear extracts from both clone 13- and ZH548-infected cells led = to=20 retardation in the electrophoretic mobility of the probe (Fig. 6D).=20 Similar results were obtained with a probe specific for ATF2/cJun = (AP-1)=20 (Fig. 6E),=20 indicating that NSs did not interfere with the NF-=CE=BAB and AP-1 = pathways.=20 Nevertheless, wild-type NSs but not clone 13 NSs was able to block = activation of an NF-=CE=BAB-responsive promoter by tumor necrosis = factor alpha=20 (Fig. 7B).=20 Likewise, activation of an AP1-responsive promoter mediated by MEK = kinase=20 overexpression was inhibited in the presence of wild-type NSs, = whereas=20 clone 13 NSs had no effect (Fig. 7C).

FIG.=20 6.

RVFV = infection=20 activates IRF-3, NF-=CE=BAB, and AP-1. (A) Dimerization of = IRF-3. 293=20 cells were infected with the indicated RVFV strains for 12 = h, and=20 formation of IRF-3 dimers was detected as described in = Materials and=20 Methods. (B) Nuclear translocation=20 (more ...)

FIG.=20 7.

(A to C) = NSs=20 protein blocks promoter activation mediated by IRF-3, = NF-=CE=BAB, and=20 AP-1. 293 cells were cotransfected with expression plasmids = for NSs=20 or GFP (as a control) and reporter constructs containing the = indicated transcription factor binding=20 (more ...)

NSs inhibits nonspecific activation of=20 transcription. Since inhibition of IFN-=CE=B2 promoter = inducibility by=20 NSs did not rely on inactivation of specific transcription = factors, we=20 analyzed the effect of NSs on nonspecific activation of = transcription in=20 the presence of trichostatin A (TSA). TSA inhibits the = deacetylation of=20 histones, leading to a less condensed state of the chromatin (31,=20 45).=20 As a consequence, the RNA polymerase II can access the DNA more = easily,=20 resulting in nonspecific activation of transcription. Thus, = various NSs=20 expression plasmids were cotransfected into 293 cells together = with a=20 reporter plasmid expressing the Renilla luciferase under = the=20 control of the SV40 early promoter. Twenty-four hours later, = transcription=20 was stimulated with TSA. Treatment with TSA resulted in activation = of the=20 SV40 early promoter, irrespective of whether the cells expressed = NSs of=20 clone 13 or green fluorescent protein (GFP) as a control (Fig. 7D).=20 In contrast, expression of wild-type NSs completely suppressed the = TSA-mediated promoter activation (Fig. 7D).=20 These results indicate that NSs is capable of inhibiting inducible = and=20 constitutive transcription alike.

DISCUSSION

The nonstructural NSs protein of RVFV is a major virulence = factor=20 subverting the innate immune defenses of the host (8,=20 40).=20 Here we demonstrate that the NSs protein blocks IFN-=CE=B1/=CE=B2 = production in=20 virus-infected cells at the transcriptional level. Induction of = IFN mRNA=20 synthesis depends critically on key cellular transcription factors = such as=20 IRF-3, NF-=CE=BAB, and AP-1, which are known to be targeted by IFN = antagonists=20 of various viruses. For example, the influenza A virus NS1 = protein, which=20 is a multifunctional protein (21),=20 prevents IRF-3 activation and subsequent IFN production by binding = to and=20 sequestering dsRNA (13,=20 39).=20 It interferes also with the activation of NF-=CE=BAB and AP-1 (28,=20 42).=20 Several other viruses express proteins that inhibit the function = of IRF-3=20 by additional mechanisms (3,=20 4,=20 7,=20 12,=20 24,=20 33,=20 34).=20 In contrast, as shown here, RVFV NSs does not affect IRF-3 = activation.=20 Likewise, NSs does not interfere with the activation of NF-=CE=BAB = or AP-1. We=20 therefore conclude that NSs does not prevent the activation of=20 IFN-specific transcription factors but acts at a subsequent step.=20 Therefore, the IFN-antagonistic activity of NSs seems to stem from = a=20 general negative effect on the host cell transcriptional = machinery. This=20 is supported by the fact that NSs (i) was capable of blocking the=20 IFN-inducing activity of a constitutively activated form of IRF-3, = (ii)=20 inhibited transcriptional activity of constitutive promoters, and = (iii)=20 prevented nonspecific upregulation by the general transcriptional=20 activator TSA. Our results are in good agreement with recent = findings=20 demonstrating that NSs targets the p44 component of the = multisubunit TFIIH=20 basal transcription factor complex, leading to a general = suppression of=20 host cellular RNA synthesis (23).=20 Therefore, it is quite likely that NSs inhibits IFN-=CE=B2 gene = transcription=20 through the same mechanism. Interestingly, the NSs protein of = Bunyamwera=20 virus (an orthobunyavirus) has no sequence similarity to NSs of = RVFV (a=20 phlebovirus) and is expressed by a different coding strategy. Yet, = it has=20 a comparable effect on host gene expression (39a)=20 and, in particular, IFN-=CE=B2 gene transcription (44).=20 Indeed, recent evidence suggests that Bunyamwera NSs targets an = important=20 process in cellular transcription, namely, serine phosphorylation = of the=20 C-terminal domain of RNA polymerase II (39a).=20 Since TFIIH is involved in RNA polymerase II phosphorylation (27,=20 35),=20 it would be interesting to know if the two unrelated NSs proteins = use the=20 same strategy.

To further elucidate the mechanism of NSs action, we introduced = several=20 mutations destroying known phosphorylation sites (20)=20 or proline-rich motifs of NSs. Interestingly, substitutions at the = major=20 phosphorylation sites were well tolerated, indicating that serine=20 phosphorylations by casein kinase II are not required for the = effector=20 function of NSs. In contrast, nuclear accumulation of NSs is = indispensable=20 for this function. We observed a clear correlation between = filament=20 formation in the nucleus and suppression of reporter gene = transcription.=20 Disruption of either of two proline-rich PXXP motifs prevented = nuclear=20 import, filament formation, and, concomitantly, inhibition of=20 transcription. Proline-rich sequences are known to mediate = protein-protein=20 interactions (6).=20 Since NSs has no nuclear localization signal, it probably gains = access to=20 the nucleus by binding to a nuclear protein of the host cell. The = p44=20 subunit of the TFIIH transcription factor interacts with NSs (23)=20 and is likely to perform this function. It remains to be = demonstrated=20 whether the inactive NSs mutants have lost the capacity to = associate with=20 p44. It should be noted, however, that clone 13 NSs which lacks = PXXP=20 motifs both 1 and 2 can no longer interact with p44 (23).

The inactive NSs mutants were defective in suppressing both = induced=20 expression driven by the IFN-=CE=B2 promoter and constitutive = expression from=20 the SV40 promoter, suggesting that a common mechanism is at work.=20 Additional mutations should help to resolve this question. An = interesting=20 example in this context is the matrix (M) protein of vesicular = stomatitis=20 virus. It inhibits transcription by all three host RNA polymerases = and is=20 also a strong inhibitor of IFN-=CE=B2 promoter activity = (1,=20 49).=20 When mutant M proteins were tested for their transcription = inhibitory=20 activity, the ability of specific mutants to suppress IFN-=CE=B2 = gene=20 expression always correlated with their ability to inhibit host = RNA=20 synthesis in general. The conclusion was that wild-type M protein=20 functions as a suppressor of IFN gene expression through its = general=20 inhibitory effect on host gene transcription (1).

NSs synthesis is a comparatively late event in the life cycle = of RVFV,=20 occurring after secondary transcription of the ambisense S = segment. To be=20 effective early on, NSs has to be a very potent repressor of = IFN-=CE=B2 gene=20 expression, as clearly indicated by the present results (Fig. 3C).=20 While IFN-=CE=B2 mRNA synthesis was induced by the NSs-deficient = clone 13 virus=20 as early as 3 h after infection, no stimulation was detectable in=20 wild-type ZH548-infected cells. Apparently, no IFN-=CE=B2 gene = transcription=20 occurred even at early time points when NSs was barely visible in = the=20 nucleus and overall mRNA synthesis was still unaffected (23).=20 Thus, the NSs-mediated block in IFN-=CE=B2 gene expression seems = to precede the=20 general decline in mRNA synthesis which occurs much later in = infection (23).=20 It is conceivable that, for transcriptional activation, inducible = genes=20 are generally much more sensitive than housekeeping genes to = quantitative=20 changes in the availability of basal transcription factors. If so, = TFIIH=20 may be a critical limiting factor for stimulated IFN-=CE=B2 gene = transcription.=20 Alternatively, NSs may target additional, and as yet unknown, = cellular=20 factors involved in IFN-=CE=B2 gene induction.

It has previously been proposed that NSs is a pathogenicity = factor=20 because of its IFN-antagonistic function in vivo (8).=20 Here we demonstrate that NSs indeed suppresses IFN-=CE=B1/=CE=B2 = synthesis. The=20 inhibitory mechanism most likely involves the basal = transcriptional=20 machinery of the host cell. It might therefore be argued that the = high=20 pathogenicity of wild-type RVFV is caused by the cytotoxic effect = of NSs=20 rather than its IFN-antagonistic activity. This, however, is = certainly not=20 the case, as demonstrated in experiments with IFN-nonresponsive = animals=20 (8).=20 The NSs-deficient clone 13 virus was more pathogenic than the = wild-type=20 virus in these animals. The lack of NSs allowed the virus to grow = faster=20 and to higher titers, causing an increase in viremia and early = death of=20 the animals. This was equally true for a reassortant wild-type = virus=20 carrying the NSs deletion of clone 13, indicating that NSs was the = decisive factor rather than some other genetic property. Thus, NSs = seems=20 to have a slowing effect on virus growth, at least in the = mammalian host.=20 This might be explained by the fact that RVFV requires capped RNA = primers=20 for its transcription which are derived from the cellular mRNA = pool in the=20 cytoplasm. In wild-type but not clone 13 virus-infected cells, the = cytoplasmic mRNA levels drop dramatically, thereby limiting viral=20 transcription. Concomitantly, the cytotoxic effect of NSs = presumably has=20 additional consequences that are not favorable for virus growth. = The=20 growth disadvantage can be envisaged as the price paid by the = virus for=20 the tremendous benefit that results from shutting down the IFN = system.=20 Recent work with Bunyamwera virus indicates that NSs has no effect = on=20 cellular transcription in the insect vector (39a).=20 If applicable to other arboviruses of the bunyavirus family, NSs = might=20 well represent a gain in function adaptation to the mammalian = host, with=20 the prime task to subvert the IFN defense system without causing = much loss=20 in general fitness.

Acknowledgments

We thank Peter Staeheli, Georg Kochs, and Nicolas Le May for = valuable=20 comments, Robert Weil for antibodies against I=CE=BAB-=CE=B2, = Stephen Goodbourn for=20 BF cells, and Takashi Fujita and John Hiscott for plasmids.

This work was supported by grant HA 1582/4-1 of the Deutsche=20 Forschungsgemeinschaft to O.H. and by a grant from the Institut = Pasteur to=20 M.B.